MiBASE   Micro-Tom Database       About us    What's new    Site Map      
Full-length cDNA;  
KaFTom      


KTU3_Contig30083      EST Members   Marker    Pathway    GO    Microarray    BLAST

>KTU3_Contig30083
TTATTTCCACTCTCCTATAAATGTATTTTGTACTGCCATCTTGTTTATGA
CATAAGAGAAAAAAAGATGGCAGTCTACAGCAAAAAAGATGATTTTCAGG
CCACAATTCAGATTAGTTATGACAAAATGAGTGACCTAATAGCCTTTGAT
GATACTAAGGCTGGTGTCAAAGGGCTTGTTGATTCCGGAATCAATAAAGT
ACCTCAAGTATTCATTCTACCGCCAAAATACAGGGTAAAAACATGTGAAA
CACACATCAGTTTTCCAGTGATAGACCTCAAAGGCATTGATGAGGATCCG
ATAAAGTATAAGGAGATTGTGGACAAAGTTCGAGATGCATCGGAGACATG
GGGTTTCTTTCAAGTGGTTAATCATGGAATTCCAACATCCATCTTGGAAA
AAACGTTACTAGGAACACGACAGTTTTTCGAGCAAGATACCGAGATCAAG
AAACAATATTACACTCGAGATATTGGGGAAAAGGTGATTTATACTAGCAA
TCTTGATTTGTATAGCCCTTCTGTTCCAGCTGCAAGTTGGAGAGACTCAA
TTTTCTTTTTCATGGCTCCGAATCCTCCTAGTCCACAAGAATTTCCAACA
GCTTGCGGGGAAATTCTAATGGACTACTCCAAGTATGTGACGGAATTGGG
GTTCTCCTTGCTTGAATTATTGTCTGAAGGTCTCGGTCTCGATCGTAGTT
ATCTGAAAGATTATATGGATTATTGCCATCAAAGTTGCTTGTGCCATTAC
TATCCATCATGCCCTCAGCCAGAACTCACCATGGGCATCAGTCAACATTC
CGACACTGAGTTTATCACGGTGCTTCTACAAGATGATATCGGTGGACTCC
AAGTTCTTCACCAAAATCAATGGTTTGATGTTCCTCCTATACGTGGTGCT
CTTGTCGTCAATATTGGAGATTTTCTGCAGCTCATGTCAAATGACAAGTA
CATGAGTGTTGAGCACAGAGCAATTGCAAAGAAAGATGGATCAAGAATGT
CAGTTGCCTGCTTCTTTGGTGAAAATCCATTGCAATCTTCAAAGCTGTAT
GAACCAATCACTGAAT



EST Members      To the top of page

83 members      alignment view
calluscrown gallflowerfruit(B,T)fruit(IMG)fruit(MG)fruit(R)fruit(mixed)fruit(ovary)leafleaf trichomesrootseedseedlingshootunknown
0002200124800000001
Developmental stages of fruit are illustrated in (1) and (2).

HTC; High Throughput cDNA (LEFL2035O18)  (go to KaFTom)
HTC; High Throughput cDNA (LEFL2027P04)  (go to KaFTom)
These are full-length cDNA clones.

EST member
LEFL2035O18LEFL2024J06LEFL2010E24LEFL2014N16LEFL2041L04LEFL2042L07LEFL2006B08LEFL2037C09LEFL2005J03LEFL2024K03
LEFL2010J18FA24AD11FA28DE01LEFL2039F18LEFL2013O10FA29BG07SGN-E276538LEFL2040L03LEFL2041N05LEFL2026A23
FA33CG11FA21AB10FA52CC06FA16AF08FA11BB04SGN-E250716SGN-E276491LEFL2027P04SGN-E261347FA19DB09
LEFL2001AH09FA28BH09SGN-E273788SGN-E274134SGN-E272114FC01AE05FA26DD10FA34BF12FA36DA02SGN-E261856
SGN-E255979SGN-E264898SGN-E251456FA13DA03SGN-E276251SGN-E252703SGN-E248739FC04BE09SGN-E276713SGN-E276711
FA03AD02FC09AB03FA02AF10FA09AC11LEFL2041L15FC26DA02FC25BD11FC15BG07SGN-E276709SGN-E276794
SGN-E260741SGN-E256401SGN-E255003SGN-E261234FC08BD01FA34CH07SGN-E257869SGN-E253779SGN-E250435FA30AB03
SGN-E260132SGN-E257586SGN-E272170SGN-E260335SGN-E259513SGN-E254251FA26BA01FA33CB11FA05AC07SGN-E255982
SGN-E251570SGN-E275151SGN-E369973-------



Marker      To the top of page

No hits found.



Pathway      To the top of page

No hits found.



Gene Ontology      To the top of page

No hits found.



Microarray      To the top of page

Affymetrix probe
Les.3627.1.S1_atExpression DataNetwork



Results of BLAST      To the top of page

Database=nr
no alignment

clone homologous sequence description clone length homologous sequence length Identities(%) Match length Mismatches Gap openings clone start clone end homologous sequence start homologous sequence end E-value bit ScoreFrame
KTU3_Contig30083gi|2218141|gb|AAB71139.1|gb|AAB71139.1| E8 protein homolog [Lycopersicon esculentum]106636499.693241094106533262e-178628+1
KTU3_Contig30083gi|119640|sp|P10967.1|ACCH3_SOLLCsp|P10967.1|ACCH3_SOLLC RecName: Full=1-aminocyclopropane-1-carboxylate oxidase homolog; AltName: Full=Protein E8///emb|CAA31789.1| E8 protein [Solanum lycopersicum]106636377.81320710106106563252e-137492+1
KTU3_Contig30083gi|147807864|emb|CAN66433.1|emb|CAN66433.1| hypothetical protein [Vitis vinifera]106636559.3131712831181065143271e-100370+1
KTU3_Contig30083gi|147818396|emb|CAN62402.1|emb|CAN62402.1| hypothetical protein [Vitis vinifera]106636758.86333137367106513293e-99365+1
KTU3_Contig30083gi|157336666|emb|CAO71351.1|emb|CAO71351.1| unnamed protein product [Vitis vinifera]106636358.5431613121181065133256e-99364+1

Database=UniProt
no alignment

clone homologous sequence description clone length homologous sequence length Identities(%) Match length Mismatches Gap openings clone start clone end homologous sequence start homologous sequence end E-value bit ScoreFrame
KTU3_Contig30083sp|P10967|ACCH3_SOLLCsp|P10967|ACCH3_SOLLC 1-aminocyclopropane-1-carboxylate oxidase homolog OS=Solanum lycopersicum GN=ACO3 PE=2 SV=1106636377.81320710106106563253e-148524+1
KTU3_Contig30083sp|Q84MB3|ACCH1_ARATHsp|Q84MB3|ACCH1_ARATH 1-aminocyclopropane-1-carboxylate oxidase homolog 1 OS=Arabidopsis thaliana GN=At1g06620 PE=2 SV=1106636553.1232014551211065123273e-95348+1
KTU3_Contig30083sp|O04847|DV4H_CATROsp|O04847|DV4H_CATRO Deacetoxyvindoline 4-hydroxylase OS=Catharanthus roseus GN=D4H PE=1 SV=2106640148.3536417894106553613e-86318+1
KTU3_Contig30083sp|Q9C5K7|ACCH2_ARATHsp|Q9C5K7|ACCH2_ARATH 1-aminocyclopropane-1-carboxylate oxidase homolog 2 OS=Arabidopsis thaliana GN=At1g06640 PE=2 SV=1106636948.623251594115106593311e-85317+1
KTU3_Contig30083sp|Q8H1S4|ACCH3_ARATHsp|Q8H1S4|ACCH3_ARATH 1-aminocyclopropane-1-carboxylate oxidase homolog 4 OS=Arabidopsis thaliana GN=At1g06650 PE=2 SV=1106636948.4732615871181065103314e-83308+1

Database=TAIR
no alignment

clone homologous sequence description clone length homologous sequence length Identities(%) Match length Mismatches Gap openings clone start clone end homologous sequence start homologous sequence end E-value bit ScoreFrame
KTU3_Contig30083AT1G06620.1AT1G06620.1 | Symbols: | 2-oxoglutarate-dependent dioxygenase, putative | chr1:2025617-2027093 FORWARD106636553.1232014551211065123273e-96348+1
KTU3_Contig30083AT5G59540.1AT5G59540.1 | Symbols: | oxidoreductase, 2OG-Fe(II) oxygenase family protein | chr5:24013519-24014802 REVERSE1066366503261557112106573283e-88322+1
KTU3_Contig30083AT5G59530.1AT5G59530.1 | Symbols: | 2-oxoglutarate-dependent dioxygenase, putative | chr5:24011660-24012941 REVERSE106636450.623241547112106563264e-88321+1
KTU3_Contig30083AT1G06640.1AT1G06640.1 | Symbols: | 2-oxoglutarate-dependent dioxygenase, putative | chr1:2032365-2033774 FORWARD106636948.623251594115106593311e-86317+1
KTU3_Contig30083AT1G03410.1AT1G03410.1 | Symbols: 2A6 | 2A6 | chr1:844781-846573 REVERSE106639846.483551845191065133619e-86313+1

Database=RAP
no alignment

clone homologous sequence description clone length homologous sequence length Identities(%) Match length Mismatches Gap openings clone start clone end homologous sequence start homologous sequence end E-value bit ScoreFrame
KTU3_Contig30083Os04g0182200|AK067970Os04g0182200|AK067970 2OG-Fe(II) oxygenase domain containing protein.;category III : InterPro domain-containing protein;GO_id No significant hit available;InterPro_id IPR005123 : 2OG-Fe(II) oxygenase;Representative_sequence AK067970106637544.41340175788106553358e-75277+1
KTU3_Contig30083Os08g0392100|Os08g0392100Os08g0392100|Os08g0392100 2OG-Fe(II) oxygenase domain containing protein.;category III : InterPro domain-containing protein;GO_id No significant hit available;InterPro_id IPR005123 : 2OG-Fe(II) oxygenase;Representative_sequence Os08g0392100106637648.383081506121101783105e-72268+1
KTU3_Contig30083Os03g0860600|AK071828Os03g0860600|AK071828 Similar to 2-oxoglutarate-dependent oxygenase.;category II : Similar to known protein;GO_id No significant hit available;InterPro_id IPR005123 : 2OG-Fe(II) oxygenase;Representative_sequence AK071828106636147.023191648121106283172e-70263+1
KTU3_Contig30083Os03g0690500|Os03g0690500Os03g0690500|Os03g0690500 2OG-Fe(II) oxygenase domain containing protein.;category III : InterPro domain-containing protein;GO_id No significant hit available;InterPro_id IPR005123 : 2OG-Fe(II) oxygenase;Representative_sequence Os03g0690500106637344.793261696121106583286e-70261+1
KTU3_Contig30083Os08g0390200|AK068286Os08g0390200|AK068286 Similar to 2-oxoglutarate-dependent oxygenase.;category II : Similar to known protein;GO_id No significant hit available;InterPro_id IPR005123 : 2OG-Fe(II) oxygenase;Representative_sequence AK068286106639645.663111577121101783111e-67253+1

Database=SGN Tomato UniGene
no alignment

clone homologous sequence description clone length homologous sequence length Identities(%) Match length Mismatches Gap openings clone start clone end homologous sequence start homologous sequence end E-value bit ScoreStrand
KTU3_Contig30083SGN-U314499SGN-U314499 Tomato 200607 #1 [82 ESTs aligned] arabidopsis/peptide: AT1G06620.1 | Symbol: None | 2-oxoglutarate-dependent dioxygenase, putative, similar to 2A6 (GI:599622) and tomato ethylene synthesis regulatory protein E8 (SP:P10967); contains Pfam profile: PF00671 Iron/Ascorbate oxidoreductase family | chr1:2025600-2027270 FORWARD | Aliases: F12K11.24, F12K11_24 (evalue: 1e-101, score=367) genbank/nr: gi|2218141|gb|AAB71139.1| E8 protein homolog [Lycopersicon esculentum] (evalue: 0, score=705)1066163010010200047106613103202022Plus
KTU3_Contig30083SGN-U338750SGN-U338750 Tomato 200607 #1 [1 ESTs aligned] arabidopsis/peptide: AT1G06620.1 | Symbol: None | 2-oxoglutarate-dependent dioxygenase, putative, similar to 2A6 (GI:599622) and tomato ethylene synthesis regulatory protein E8 (SP:P10967); contains Pfam profile: PF00671 Iron/Ascorbate oxidoreductase family | chr1:2025600-2027270 FORWARD | Aliases: F12K11.24, F12K11_24 (evalue: 2e-40, score=162) genbank/nr: gi|2218141|gb|AAB71139.1| E8 protein homolog [Lycopersicon esculentum] (evalue: 2e-97, score=358)106669796.769818499792169701176Plus
KTU3_Contig30083SGN-U338747SGN-U338747 Tomato 200607 #1 [1 ESTs aligned] arabidopsis/peptide: AT1G06620.1 | Symbol: None | 2-oxoglutarate-dependent dioxygenase, putative, similar to 2A6 (GI:599622) and tomato ethylene synthesis regulatory protein E8 (SP:P10967); contains Pfam profile: PF00671 Iron/Ascorbate oxidoreductase family | chr1:2025600-2027270 FORWARD | Aliases: F12K11.24, F12K11_24 (evalue: 6e-31, score=132) genbank/nr: gi|2218141|gb|AAB71139.1| E8 protein homolog [Lycopersicon esculentum] (evalue: 3e-59, score=231)106670398.26460713057642457030841Plus
KTU3_Contig30083SGN-U314505SGN-U314505 Tomato 200607 #1 [510 ESTs aligned] arabidopsis/peptide: AT1G06620.1 | Symbol: None | 2-oxoglutarate-dependent dioxygenase, putative, similar to 2A6 (GI:599622) and tomato ethylene synthesis regulatory protein E8 (SP:P10967); contains Pfam profile: PF00671 Iron/Ascorbate oxidoreductase family | chr1:2025600-2027270 FORWARD | Aliases: F12K11.24, F12K11_24 (evalue: 1e-106, score=383) genbank/nr: gi|19199|emb|CAA31789.1| E8 protein [Lycopersicon esculentum] >gi|119640|sp|P10967|ACCO3_LYCES 1-aminocyclopropane-1-carboxylate oxidase homolog (Protein E8) (evalue: 0, score=718)1066148285.61952137011510667310240801Plus
KTU3_Contig30083SGN-U314506SGN-U314506 Tomato 200607 #1 [35 ESTs aligned] arabidopsis/peptide: AT1G06620.1 | Symbol: None | 2-oxoglutarate-dependent dioxygenase, putative, similar to 2A6 (GI:599622) and tomato ethylene synthesis regulatory protein E8 (SP:P10967); contains Pfam profile: PF00671 Iron/Ascorbate oxidoreductase family | chr1:2025600-2027270 FORWARD | Aliases: F12K11.24, F12K11_24 (evalue: 5e-51, score=199) genbank/nr: gi|19199|emb|CAA31789.1| E8 protein [Lycopersicon esculentum] >gi|119640|sp|P10967|ACCO3_LYCES 1-aminocyclopropane-1-carboxylate oxidase homolog (Protein E8) (evalue: 2e-97, score=359)1066147488.454855601155992367204e-146517Plus
KTU3_Contig30083SGN-U314506SGN-U314506 Tomato 200607 #1 [35 ESTs aligned] arabidopsis/peptide: AT1G06620.1 | Symbol: None | 2-oxoglutarate-dependent dioxygenase, putative, similar to 2A6 (GI:599622) and tomato ethylene synthesis regulatory protein E8 (SP:P10967); contains Pfam profile: PF00671 Iron/Ascorbate oxidoreductase family | chr1:2025600-2027270 FORWARD | Aliases: F12K11.24, F12K11_24 (evalue: 5e-51, score=199) genbank/nr: gi|19199|emb|CAA31789.1| E8 protein [Lycopersicon esculentum] >gi|119640|sp|P10967|ACCO3_LYCES 1-aminocyclopropane-1-carboxylate oxidase homolog (Protein E8) (evalue: 2e-97, score=359)1066147483.78450730617106692613751e-84313Plus

Database=DFCI Tomato Gene Index
no alignment

clone homologous sequence description clone length homologous sequence length Identities(%) Match length Mismatches Gap openings clone start clone end homologous sequence start homologous sequence end E-value bit ScoreStrand
KTU3_Contig30083TC192811TC192811 UniRef100_O24018 Cluster: E8 protein homolog; n=1; Solanum lycopersicum|Rep: E8 protein homolog - Solanum lycopersicum (Tomato) (Lycopersicon esculentum), complete1066160610010200047106614103302022Plus
KTU3_Contig30083DB720802DB720802 homologue to UniRef100_O24018 Cluster: E8 protein homolog; n=1; Solanum lycopersicum|Rep: E8 protein homolog - Solanum lycopersicum (Tomato) (Lycopersicon esculentum), partial (56%)106675497.357551645759175101336Plus
KTU3_Contig30083BM410862BM410862 UniRef100_O24018 Cluster: E8 protein homolog; n=1; Solanum lycopersicum|Rep: E8 protein homolog - Solanum lycopersicum (Tomato) (Lycopersicon esculentum), partial (53%)1066643100579002588366564301148Plus
KTU3_Contig30083TC193327TC193327 UniRef100_P10967 Cluster: 1-aminocyclopropane-1-carboxylate oxidase homolog; n=1; Solanum lycopersicum|Rep: 1-aminocyclopropane-1-carboxylate oxidase homolog - Solanum lycopersicum (Tomato) (Lycopersicon esculentum), complete1066140485.61952137011510665410050801Plus
KTU3_Contig30083TC200045TC200045 UniRef100_P10967 Cluster: 1-aminocyclopropane-1-carboxylate oxidase homolog; n=1; Solanum lycopersicum|Rep: 1-aminocyclopropane-1-carboxylate oxidase homolog - Solanum lycopersicum (Tomato) (Lycopersicon esculentum), partial (77%)106695285.918161150115930628770706Plus